pET21d_SNORD78_probe
(Plasmid
#73072)
-
Purposeantisense probe for detection of human SNORD78 (C/D box snoRNA U78)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73072 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET21d
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSNORD78
-
SpeciesH. sapiens (human)
-
Insert Size (bp)79
-
Entrez GeneSNORD78 (a.k.a. U78)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer GGGGTTTGTGTAATGATGTT
- 3′ sequencing primer CACAGGGTTCTTCAGTGTTA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET21d_SNORD78_probe was a gift from Stefan Stamm (Addgene plasmid # 73072 ; http://n2t.net/addgene:73072 ; RRID:Addgene_73072) -
For your References section:
Dual function of C/D box small nucleolar RNAs in rRNA modification and alternative pre-mRNA splicing. Falaleeva M, Pages A, Matuszek Z, Hidmi S, Agranat-Tamir L, Korotkov K, Nevo Y, Eyras E, Sperling R, Stamm S. Proc Natl Acad Sci U S A. 2016 Mar 22;113(12):E1625-34. doi: 10.1073/pnas.1519292113. Epub 2016 Mar 8. 10.1073/pnas.1519292113 PubMed 26957605