pZW1-snoVector
(Plasmid #73174)

• Purpose: Nuclear expression of RNAs
• Depositing Lab: Ling-Ling Chen
• Publication: Yin et al Nucleic Acids Res. 2015 Jan;43(1):e5. doi: 10.1093/nar/gku1050. Epub 2014 Nov 5.

Backbone

• Vector backbone: pZW1
• Backbone manufacturer: Zefeng Wang's lab
• Backbone size w/o insert (bp): 4700
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: SNORD116-13
• Alt name: HBII-85-13
• Species: H. sapiens (human)
• Insert Size (bp): 94
• GenBank ID: 100033425
• Entrez Gene: SNORD116-13 (a.k.a. HBII-85-13)
• Promoter: CMV promoter

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (destroyed during cloning)
• 3′ cloning site: SacII (destroyed during cloning)
• 5′ sequencing primer: EGFP-Seq-5F: GACCACATGAAGCAGCACGA

Gene/Insert 2

• Gene/Insert name: SNORD116-14
• Alt name: HBII-85-14
• Species: H. sapiens (human)
• Insert Size (bp): 107
• GenBank ID: 100033426
• Entrez Gene: SNORD116-14 (a.k.a. HBII-85-14)
• Promoter: CMV promoter

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (destroyed during cloning)
• 3′ cloning site: SacII (destroyed during cloning)
• 5′ sequencing primer: EGFP-Seq-5F: GACCACATGAAGCAGCACGA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Two snoRNA genes SNORD116-13 and SNORD116-14 from the Prader–Willi syndrome deletion region flanked by multiple cloning sites were inserted into the weak intron of Enhanced Green Fluoresence Protein (EGFP) such that only proper splicing leads to EGFP fluorescence.