Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

HA-mRIPK3 D161N-Flag/cHA-pTRIPZ vector
(Plasmid #73705)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73705 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTRIPZ
  • Backbone manufacturer
    GE Dharmacon
  • Backbone size w/o insert (bp) 12300
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RIPK3
  • Species
    M. musculus (mouse)
  • Mutation
    D161N
  • Entrez Gene
    Ripk3 (a.k.a. 2610528K09Rik, Rip3)
  • Promoter CMV/tet
  • Tags / Fusion Proteins
    • HA (N terminal on backbone)
    • Flag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer acggtgggaggcctatataagc
  • 3′ sequencing primer tcgctgcgcccttcgtctgacg
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HA-mRIPK3 D161N-Flag/cHA-pTRIPZ vector was a gift from Francis Chan (Addgene plasmid # 73705 ; http://n2t.net/addgene:73705 ; RRID:Addgene_73705)