Skip to main content

pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA
(Plasmid #73796)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73796 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pRS416
  • Backbone manufacturer
    https://www.addgene.org/vector-database/3985/
  • Backbone size w/o insert (bp) 4898
  • Total vector size (bp) 12554
  • Modifications to backbone
    Cut between multiple cloning site and PciI site outside of the multiple cloning site so part of vector is missing
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    dCas9-Mxi1
  • Species
    Synthetic; S pyogenes Cas9
  • Insert Size (bp)
    4344
  • Mutation
    D10A, H840A
  • Promoter pTef1
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)
    • Mxi1 (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCTTTCGATGACCTCCCATTG
  • 3′ sequencing primer gtaatacgactcactataggg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Tet Repressor
  • Alt name
    TetR
  • Species
    Bacterial
  • Insert Size (bp)
    624
  • Promoter pGPM1

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gagtacaaacgcatgaaatcc
  • 3′ sequencing primer CGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Structural gRNA for S pyogenes
  • Alt name
    sgRNA
  • Species
    Synthetic; S pyogenes
  • Insert Size (bp)
    82
  • Promoter pRPR1(TetO)

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cagcaacgcggcctttttacggttcctggcc
  • 3′ sequencing primer CAGGAAAGACCGCGGcttaaagtcatacattgcacgacta
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Cas9 gene was received from DiCarlo et al.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Detailed benchling plasmid map available at: https://benchling.com/s/0WUKQB/edit
All annotations are available there. This is best reference to use for this plasmid. The genbank file included was exported from benchling for this plasmid.

Please note to clone in gRNAs you need to use Gibson Assembly. Gibson will chew back the NotI overhangs. Provide homology on either side of the cut site to clone. Generally we order 60mers with 20bp of homology to the promoter and to the terminator. For high efficiency amplify with primers that extend these homologies to 30-40bp. You can directly clone in single stranded oligo with 20bp overlaps using Gibson if you only need low efficiency. To do this use ~100x oligo to plasmid. For double stranded PCR product, use ratios between to 2:1 to 10:1 insert to plasmid. See paper methods for more details.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA was a gift from Ronald Davis (Addgene plasmid # 73796 ; http://n2t.net/addgene:73796 ; RRID:Addgene_73796)
  • For your References section:

    Quantitative CRISPR interference screens in yeast identify chemical-genetic interactions and new rules for guide RNA design. Smith JD, Suresh S, Schlecht U, Wu M, Wagih O, Peltz G, Davis RW, Steinmetz LM, Parts L, St Onge RP. Genome Biol. 2016 Mar 8;17(1):45. doi: 10.1186/s13059-016-0900-9. 10.1186/s13059-016-0900-9 [pii] PubMed 26956608