pGex-4T-2_GEC1
(Plasmid
#73945)
-
PurposeFor recombinant expression of human GEC1/GABARAPL1 in E. coli
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73945 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGex-4T-2
-
Backbone manufacturerGE Healthcare Life Sciences
- Backbone size w/o insert (bp) 4970
- Total vector size (bp) 5320
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGEC1
-
Alt nameGABARAPL1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)351
-
Entrez GeneGABARAPL1 (a.k.a. APG8-LIKE, APG8L, ATG8, ATG8B, ATG8L, GEC1)
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH I (not destroyed)
- 3′ cloning site Not I (not destroyed)
- 5′ sequencing primer CCAGCAAGTATATAGCATGG
- 3′ sequencing primer GCTTACAGACAAGCTGTGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGex-4T-2_GEC1 was a gift from Dieter Willbold (Addgene plasmid # 73945 ; http://n2t.net/addgene:73945 ; RRID:Addgene_73945) -
For your References section:
Interaction of Bcl-2 with the autophagy-related GABAA receptor-associated protein (GABARAP): biophysical characterization and functional implications. Ma P, Schwarten M, Schneider L, Boeske A, Henke N, Lisak D, Weber S, Mohrluder J, Stoldt M, Strodel B, Methner A, Hoffmann S, Weiergraber OH, Willbold D. J Biol Chem. 2013 Dec 27;288(52):37204-15. doi: 10.1074/jbc.M113.528067. Epub 2013 Nov 15. 10.1074/jbc.M113.528067 PubMed 24240096