Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA3-Myc-AIM2
(Plasmid #73958)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73958 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size w/o insert (bp) 5459
  • Total vector size (bp) 6600
  • Modifications to backbone
    A c-myc tag and a modified MCS were inserted as indicated in the attached plasmid map.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    absent in melanoma 2 (AIM2)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1050
  • GenBank ID
    NM_004833.1
  • Entrez Gene
    AIM2 (a.k.a. PYHIN4)
  • Promoter CMV iE
  • Tag / Fusion Protein
    • c-myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer T7 promoter (TAATACGACTCACTATAGGG)
  • 3′ sequencing primer SP6 promoter (ATTTAGGTGACACTATAG)
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-Myc-AIM2 was a gift from Christian Stehlik (Addgene plasmid # 73958 ; http://n2t.net/addgene:73958 ; RRID:Addgene_73958)
  • For your References section:

    The PYRIN domain-only protein POP3 inhibits ALR inflammasomes and regulates responses to infection with DNA viruses. Khare S, Ratsimandresy RA, de Almeida L, Cuda CM, Rellick SL, Misharin AV, Wallin MC, Gangopadhyay A, Forte E, Gottwein E, Perlman H, Reed JC, Greaves DR, Dorfleutner A, Stehlik C. Nat Immunol. 2014 Apr;15(4):343-53. doi: 10.1038/ni.2829. Epub 2014 Feb 16. 10.1038/ni.2829 PubMed 24531343