CpcB-Solanum-lycopersicumPHLS_CpcA
(Plasmid #74003)

• Purpose: Expresses the Solanum lycopersicum PHLS as a fusion with the CpcB protein plus the NPPS and CmR cassete in Synechocystis
• Depositing Lab: Anastasios Melis
• Publication: Formighieri et al Planta. 2018 Oct;248(4):933-946. doi: 10.1007/s00425-018-2948-0. Epub 2018 Jul 4.

Backbone

• Vector backbone: pBluescript KS+
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 2877
• Total vector size (bp): 8384

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: PHLS and CmR
• Alt name: Solanum lycopersicum phellandrene synthase (PHLS) fused to CpcB plus NPPS andCmR
• Species: Synechocystis and Solanum lycopersicum
• Insert Size (bp): 4213
• GenBank ID: ACO56896.1 AGF50922.1
• Promoter: cpc

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: aagagtccctgaatatcaaa
• 3′ sequencing primer: AGATCTCTAGTGGTTTAACG

Gene/Insert 2

• Gene/Insert name: Neryl diphosphate synthase from Solanum lycopersicum
• Alt name: NPPS
• Insert Size (bp): 784
• GenBank ID: ACO56895.1

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TCACATTCTAACGGGAGATA
• 3′ sequencing primer: ctagctcagagcattgatgg

Resource Information

• Supplemental Documents:
  • CpcB-Solanum-lycopersicumPHLS_CpcA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry