CpcBfull-NaGLS fusion_CpcA
(Plasmid #74004)

• Purpose: Expresses the Nicotiana attenuata GLS as a fusion with the CpcB protein plus the CmR cassete in Synechocystis
• Depositing Lab: Anastasios Melis
• Publication: Formighieri et al Planta. 2018 Oct;248(4):933-946. doi: 10.1007/s00425-018-2948-0. Epub 2018 Jul 4.

Backbone

• Vector backbone: pBluescript KS+
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 2877
• Total vector size (bp): 7963

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NaGLS and CmR
• Alt name: Nicotiana attenuata geranyl linalool synthase fused to CpcB plus CmR
• Species: Synechocystis and Nicotiana attenuata
• Insert Size (bp): 5086
• GenBank ID: KJ755868 AGF50922.1
• Promoter: cpc

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: aagagtccctgaatatcaaa
• 3′ sequencing primer: ctagctcagagcattgatgg

Resource Information

• Supplemental Documents:
  • pCpcBfull-NaGLS fusion_CpcA
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry