B0030m_BC
(Plasmid
#74394)
-
PurposeMoClo Basic Part: RBS - Weiss RBS, high strength. Modified from Bba_B0030 to adjust spacing in MC system. [B:B0030m:C]
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74394 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneDVA
- Backbone size w/o insert (bp) 2100
- Total vector size (bp) 2132
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRBS
-
Alt nameBasic part - RBS
-
SpeciesSynthetic
-
Insert Size (bp)32
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer TGCCACCTGACGTCTAAGAA
- 3′ sequencing primer ATTACCGCCTTTGAGTGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
B0030m_BC was a gift from Douglas Densmore (Addgene plasmid # 74394 ; http://n2t.net/addgene:74394 ; RRID:Addgene_74394)