ZIKV_NASBA_27B
(Plasmid
#75010)
-
PurposePortion of Zika Virus genome (KU312312: 1248-1594) containing sensor 27B trigger sequence and NASBA amplification sites
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75010 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET-15b
-
Backbone manufacturerEMD Millipore
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZIKV_NASBA_27B
-
SpeciesSynthetic
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer pBRrevBam (GGTGATGTCGGCGATATAGG)
- 3′ sequencing primer pBEST-R (TCTCATGTTTGACAGCTTATC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ZIKV_NASBA_27B was a gift from James Collins & Alexander Green (Addgene plasmid # 75010 ; http://n2t.net/addgene:75010 ; RRID:Addgene_75010) -
For your References section:
Rapid, Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Pardee K, Green AA, Takahashi MK, Braff D, Lambert G, Lee JW, Ferrante T, Ma D, Donghia N, Fan M, Daringer NM, Bosch I, Dudley DM, O'Connor DH, Gehrke L, Collins JJ. Cell. 2016 May 6. pii: S0092-8674(16)30505-0. doi: 10.1016/j.cell.2016.04.059. 10.1016/j.cell.2016.04.059 PubMed 27160350