Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCRISPRainbow-DONOR1
(Plasmid #75398)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 75398 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2000
  • Total vector size (bp) 3524
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cm(R)-CcdB
  • Promoter Bacteria
  • Tag / Fusion Protein
    • no

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Mlu I (not destroyed)
  • 3′ cloning site Pci I (not destroyed)
  • 5′ sequencing primer GCTACAACAAGGCAAGGCTTGACCGA
  • 3′ sequencing primer AACGCCAGCAACGCGGCCTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Want all of the CRISPRainbow constructs? Request the set here: https://www.addgene.org/kits/pederson-crisprainbow/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPRainbow-DONOR1 was a gift from Thoru Pederson (Addgene plasmid # 75398 ; http://n2t.net/addgene:75398 ; RRID:Addgene_75398)
  • For your References section:

    Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Ma H, Tu LC, Naseri A, Huisman M, Zhang S, Grunwald D, Pederson T. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. 10.1038/nbt.3526 PubMed 27088723