pEGB SF-35S:Renilla:TNOS-35S:P19:TNOS (GB0160)
(Plasmid
#75412)
-
PurposeModule for the expression of the Renilla Luciferase with the silencing suppressor P19
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 75412 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDGB1alpha2
-
Backbone manufacturerself-made; derived from pGreenII generated at the JIC
- Backbone size w/o insert (bp) 2597
- Total vector size (bp) 7287
-
Vector typePlant Expression, Luciferase, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRenilla / P19
-
SpeciesRenilla reniformis / Tomato bushy stunt virus (TBSV)
-
Insert Size (bp)4690
- Promoter 35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer caacctctcgggcttctgga (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGB SF-35S:Renilla:TNOS-35S:P19:TNOS (GB0160) was a gift from Diego Orzaez (Addgene plasmid # 75412 ; http://n2t.net/addgene:75412 ; RRID:Addgene_75412) -
For your References section:
A modular toolbox for gRNA-Cas9 genome engineering in plants based on the GoldenBraid standard. Vazquez-Vilar M, Bernabe-Orts JM, Fernandez-Del-Carmen A, Ziarsolo P, Blanca J, Granell A, Orzaez D. Plant Methods. 2016 Feb 1;12:10. doi: 10.1186/s13007-016-0101-2. eCollection 2016. 101 [pii] PubMed 26839579