This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pZA16mflon
(Plasmid #75439)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 75439 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pZA11
  • Modifications to backbone
    replaced pLtetO promoter with arabinose inducible pBAD promoter
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mf-lon
  • Species
    Mesoplasma florum
  • Promoter pBAD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CTCGAGAAGAAACCAATTGTC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZA16mflon was a gift from James Collins (Addgene plasmid # 75439 ; http://n2t.net/addgene:75439 ; RRID:Addgene_75439)
  • For your References section:

    Tunable protein degradation in bacteria. Cameron DE, Collins JJ. Nat Biotechnol. 2014 Dec;32(12):1276-81. doi: 10.1038/nbt.3053. Epub 2014 Nov 17. 10.1038/nbt.3053 PubMed 25402616