pTpal-fdc
(Plasmid #78288)

• Purpose: Expresses A. thaliana PAL2 and S. cerevisiae FDC1 in E. coli
• Depositing Lab: David Nielsen
• Publication: McKenna et al Biotechnol J. 2013 Dec;8(12):1465-75. doi: 10.1002/biot.201300035. Epub 2013 Jul 29.

Backbone

• Vector backbone: pTrc99A
• Backbone size w/o insert (bp): 4176
• Total vector size (bp): 7837
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: PAL2
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 2154
• Mutation: *see below
• Entrez Gene: PAL2 (a.k.a. AT3G53260, ATPAL2, phenylalanine ammonia-lyase 2)
• Promoter: trc

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: acacaggaaacagaccatgg
• 3′ sequencing primer: TCTAGATTAGCAAATCGGAA

Gene/Insert 2

• Gene/Insert name: FDC1
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 1512
• Entrez Gene: FDC1 (a.k.a. YDR539W)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: SbfI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: TCTAGATTAGCAAATCGGAA
• 3′ sequencing primer: CGCCAAAACAGCCAAGCTT

Resource Information

• Supplemental Documents:
  • pTpal-fdc Genbank file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

*Note: Addgene's quality control sequencing finds an E50A amino acid residue substitution in the A. thaliana PAL2 gene insert. The depositing laboratory does not believe this residue change will affect protein function. This plasmid accurately reflects the construct as it was used in the associated publication.