AAV-FLEX-EGFP-mir30(Scn9a)
(Plasmid
#79672)
-
PurposeCre-dependent knockdown of Scn9a (Nav1.7)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 79672 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV
- Backbone size w/o insert (bp) 4978
- Total vector size (bp) 6087
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEGFP
-
gRNA/shRNA sequenceScn9a
-
SpeciesM. musculus (mouse); jellyfish
-
GenBank IDNM_001290674.1
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe1 (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer ctgacaacgggccacaactc
- 3′ sequencing primer GTATATGTGCTGCCGAAGCG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-FLEX-EGFP-mir30(Scn9a) was a gift from Scott Sternson (Addgene plasmid # 79672 ; http://n2t.net/addgene:79672 ; RRID:Addgene_79672) -
For your References section:
Near-Perfect Synaptic Integration by Nav1.7 in Hypothalamic Neurons Regulates Body Weight. Branco T, Tozer A, Magnus CJ, Sugino K, Tanaka S, Lee AK, Wood JN, Sternson SM. Cell. 2016 Jun 16;165(7):1749-61. doi: 10.1016/j.cell.2016.05.019. 10.1016/j.cell.2016.05.019 PubMed 27315482