Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAM-PAT-ProUBQ10 GW
(Plasmid #79751)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 79751 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Binary vector pAMPAT-MCS
  • Modifications to backbone
    exchange of Pro35S to ProUBQ10
  • Vector type
    Plant Expression
  • Promoter ProUBQ10
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
    37┬░C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gaccggcaacaggattcaatcttaag
  • 3′ sequencing primer GAATTAGAAATTTTATTGATAGAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Arp Schnittger, Stefan Pusch, Universit├Ąt Hamburg
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAM-PAT-ProUBQ10 GW was a gift from Nico Dissmeyer & Arp Schnittger (Addgene plasmid # 79751 ; http://n2t.net/addgene:79751 ; RRID:Addgene_79751)
  • For your References section:

    Phenotypes on demand via switchable target protein degradation in multicellular organisms. Faden F, Ramezani T, Mielke S, Almudi I, Nairz K, Froehlich MS, Hockendorff J, Brandt W, Hoehenwarter W, Dohmen RJ, Schnittger A, Dissmeyer N. Nat Commun. 2016 Jul 22;7:12202. doi: 10.1038/ncomms12202. 10.1038/ncomms12202 PubMed 27447739