pAM PAT-ProCPC GW
(Plasmid
#79757)
-
Purpose(Empty Backbone) binary DEST vector for plant expression
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79757 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneBinary vector pAMPAT-MCS
-
Modifications to backboneexchange of Pro35S to ProCPC
-
Vector typePlant Expression
- Promoter ProCPC
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberLow Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gaccggcaacaggattcaatcttaag
- 3′ sequencing primer GAATTAGAAATTTTATTGATAGAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMartin Hülskamp, Martina Pesch
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAM PAT-ProCPC GW was a gift from Nico Dissmeyer & Martin Hulskamp (Addgene plasmid # 79757 ; http://n2t.net/addgene:79757 ; RRID:Addgene_79757) -
For your References section:
Mutual control of intracellular localisation of the patterning proteins AtMYC1, GL1 and TRY/CPC in Arabidopsis. Pesch M, Schultheiss I, Digiuni S, Uhrig JF, Hulskamp M. Development. 2013 Aug;140(16):3456-67. doi: 10.1242/dev.094698. 10.1242/dev.094698 PubMed 23900543