pCR4-TOPO-pTARBAC-iTol2-Amp
(Plasmid
#79890)
-
PurposeExtended iTol2-Amp cassette for integration of Tol2 arms into BAC clones with pTARBAC backbone. Cassette contains long homologous recombination arms (5’arm-224bp and 3’arm-221bp) that flank loxP sites
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79890 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCR4-TOPO
- Total vector size (bp) 5774
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameExtended iTol2-Amp cassette for integration of Tol2 arms into BAC clones with pTARBAC backbone
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)1818
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer GCTGTCGGAATGGACGATA
- 3′ sequencing primer GCAAGTATTGACATGTCGTCGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKawakami iTol2 cassette
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCR4-TOPO-pTARBAC-iTol2-Amp was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 79890) -
For your References section:
Biotagging of Specific Cell Populations in Zebrafish Reveals Gene Regulatory Logic Encoded in the Nuclear Transcriptome. Trinh LA, Chong-Morrison V, Gavriouchkina D, Hochgreb-Hagele T, Senanayake U, Fraser SE, Sauka-Spengler T. Cell Rep. 2017 Apr 11;19(2):425-440. doi: 10.1016/j.celrep.2017.03.045. 10.1016/j.celrep.2017.03.045 PubMed 28402863