pcDNA4/TO/FLAG-hPMR1(2H)-Tev-Bio
(Plasmid #80325)

• Purpose: Expresses a catalytically inactive form of human PMR1 endonuclease with N-terminal FLAG and C-terminal biotinylation tags
• Depositing Lab: Daniel Schoenberg
• Publication: Gu et al RNA. 2012 Jun;18(6):1186-96. doi: 10.1261/rna.031369.111. Epub 2012 Apr 27.

Backbone

• Vector backbone: pcDNA4/TO
• Backbone manufacturer: Thermo Fisher Scientific
• Backbone size w/o insert (bp): 4987
• Total vector size (bp): 6897
• Vector type: Mammalian Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PXDNL-003
• Alt name: hPMR1
• Species: H. sapiens (human)
• Insert Size (bp): 1910
• Mutation: H170A and H256A
• GenBank ID: BC132813
• Entrez Gene: PXDNL (a.k.a. PMR1, PRM1, VPO2)
• Promoter: CMV
• Tag / Fusion Protein:
  • Biotin (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (unknown if destroyed)
• 3′ cloning site: ApaI (unknown if destroyed)
• 5′ sequencing primer: cggcgtgccgggtgttcatgggg
• 3′ sequencing primer: ggcgtccctgagccgggtgctttgtg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

hPMR1 corresponds to Ensembl transcript PXDNL-003. In this form of the protein the 2 histidine residues that correspond to the active site have been changed to alanine to generate a catalytically inactive protein.

Please note that the hPMR1 insert in this plasmid is numbered starting with the first methionine in GenBank reference sequence BC132813. This plasmid does not encode the 1463 aa PXDNL protein in GenBank NM_144651.4