Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #80325)


Item Catalog # Description Quantity Price (USD)
Plasmid 80325 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 4987
  • Total vector size (bp) 6897
  • Vector type
    Mammalian Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    H170A and H256A
  • GenBank ID
  • Entrez Gene
    PXDNL (a.k.a. PMR1, PRM1, VPO2)
  • Promoter CMV
  • Tag / Fusion Protein
    • Biotin (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site ApaI (unknown if destroyed)
  • 5′ sequencing primer cggcgtgccgggtgttcatgggg
  • 3′ sequencing primer ggcgtccctgagccgggtgctttgtg
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

hPMR1 corresponds to Ensembl transcript PXDNL-003. In this form of the protein the 2 histidine residues that correspond to the active site have been changed to alanine to generate a catalytically inactive protein.

Please note that the hPMR1 insert in this plasmid is numbered starting with the first methionine in GenBank reference sequence BC132813. This plasmid does not encode the 1463 aa PXDNL protein in GenBank NM_144651.4

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA4/TO/FLAG-hPMR1(2H)-Tev-Bio was a gift from Daniel Schoenberg (Addgene plasmid # 80325 ; ; RRID:Addgene_80325)
  • For your References section:

    Identification of the human PMR1 mRNA endonuclease as an alternatively processed product of the gene for peroxidasin-like protein. Gu SQ, Bakthavachalu B, Han J, Patil DP, Otsuka Y, Guda C, Schoenberg DR. RNA. 2012 Jun;18(6):1186-96. doi: 10.1261/rna.031369.111. Epub 2012 Apr 27. 10.1261/rna.031369.111 PubMed 22543864