pAM-PAT-35S-GW-Luc
(Plasmid
#80678)
-
Purpose(Empty Backbone) binary DEST vector for plant expression
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80678 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneBinary vector pAMPAT-MCS
-
Modifications to backboneintroduction of firefly Luciferase 3' of Gateway site to create C-terminal fusions
-
Vector typePlant Expression
- Promoter Pro35S
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Growth instructionsccdB Survival can also be used for tranformation
-
Copy numberLow Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gaccggcaacaggattcaatcttaag
- 3′ sequencing primer GAATTAGAAATTTTATTGATAGAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byElke Logemann, Imre Somssich
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAM-PAT-35S-GW-Luc was a gift from Nico Dissmeyer & Imre Somssich (Addgene plasmid # 80678 ; http://n2t.net/addgene:80678 ; RRID:Addgene_80678)