Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #80685)


Item Catalog # Description Quantity Price (USD)
Plasmid 80685 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    Binary vector pAMPAT-MCS
  • Modifications to backbone
    exchange of Pro35S to ProCDKA;1
  • Vector type
    Plant Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
  • Species
    A. thaliana (mustard weed)
  • Entrez Gene
    CDC2 (a.k.a. AT3G48750, CDC2A, CDC2AAT, CDK2, CDKA1, CDKA;1, CYCLIN-DEPENDENT KINASE A;1, P34CDC2, cell division control 2)
  • Promoter ProCDKA;1
  • Tag / Fusion Protein
    • YFP (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gaccggcaacaggattcaatcttaag
  • 3′ sequencing primer GAATTAGAAATTTTATTGATAGAAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAM-PAT-ProCDKA;1::CDKA;1:YFP was a gift from Nico Dissmeyer & Arp Schnittger (Addgene plasmid # 80685 ; ; RRID:Addgene_80685)
  • For your References section:

    Bypassing genomic imprinting allows seed development. Nowack MK, Shirzadi R, Dissmeyer N, Dolf A, Endl E, Grini PE, Schnittger A. Nature. 2007 May 17;447(7142):312-5. Epub 2007 Apr 29. 10.1038/nature05770 PubMed 17468744