This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAM-PAT-ProGL2 GW
(Plasmid #80689)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80689 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Binary vector pAMPAT-MCS
  • Modifications to backbone
    exchange of Pro35S to ProGL2
  • Vector type
    Plant Expression
  • Promoter ProGL2
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gaccggcaacaggattcaatcttaag
  • 3′ sequencing primer GAATTAGAAATTTTATTGATAGAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Martin Hülskamp, Daniel Buoyer
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAM-PAT-ProGL2 GW was a gift from Nico Dissmeyer & Arp Schnittger (Addgene plasmid # 80689 ; http://n2t.net/addgene:80689 ; RRID:Addgene_80689)
  • For your References section:

    Novel functions of plant cyclin-dependent kinase inhibitors, ICK1/KRP1, can act non-cell-autonomously and inhibit entry into mitosis. Weinl C, Marquardt S, Kuijt SJ, Nowack MK, Jakoby MJ, Hulskamp M, Schnittger A. Plant Cell. 2005 Jun;17(6):1704-22. Epub 2005 Mar 4. 10.1105/tpc.104.030486 PubMed 15749764