pAM-PAT-ProGL2 GW
(Plasmid
#80689)
-
Purpose(Empty Backbone) binary DEST vector for plant expression
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80689 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneBinary vector pAMPAT-MCS
-
Modifications to backboneexchange of Pro35S to ProGL2
-
Vector typePlant Expression
- Promoter ProGL2
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberLow Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gaccggcaacaggattcaatcttaag
- 3′ sequencing primer GAATTAGAAATTTTATTGATAGAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMartin Hülskamp, Daniel Buoyer
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAM-PAT-ProGL2 GW was a gift from Nico Dissmeyer & Arp Schnittger (Addgene plasmid # 80689 ; http://n2t.net/addgene:80689 ; RRID:Addgene_80689) -
For your References section:
Novel functions of plant cyclin-dependent kinase inhibitors, ICK1/KRP1, can act non-cell-autonomously and inhibit entry into mitosis. Weinl C, Marquardt S, Kuijt SJ, Nowack MK, Jakoby MJ, Hulskamp M, Schnittger A. Plant Cell. 2005 Jun;17(6):1704-22. Epub 2005 Mar 4. 10.1105/tpc.104.030486 PubMed 15749764