pMT-HuC:Dendra2
(Plasmid
#80904)
-
PurposeInjection into Zebrafish larvae together with Tol2-Transposase to achieve pan-neuronal expression of the photoconvertible fluorescent protein Dendra2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 80904 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMTB
- Backbone size w/o insert (bp) 6897
- Total vector size (bp) 7614
-
Vector typeZebrafish Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDendra2
-
SpeciesSynthetic
-
Insert Size (bp)717
-
GenBank IDAF_173984
- Promoter HuC
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer atctttgtacgtcaagacctagg
- 3′ sequencing primer taatacgactcactatagggag (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMT-HuC:Dendra2 was a gift from Periklis Pantazis (Addgene plasmid # 80904 ; http://n2t.net/addgene:80904 ; RRID:Addgene_80904) -
For your References section:
Labeling cellular structures in vivo using confined primed conversion of photoconvertible fluorescent proteins. Mohr MA, Argast P, Pantazis P. Nat Protoc. 2016 Dec;11(12):2419-2431. doi: 10.1038/nprot.2016.134. Epub 2016 Nov 3. 10.1038/nprot.2016.134 PubMed 27809312