Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

DH10B E. coli aptI/gidB::Landing Pad
(Bacterial strain #83036)

Full plasmid sequence is not available for this item.

No maps are available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Bacterial Strain 83036 Bacteria in agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    none

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B E. coli aptI/gidB::Landing Pad
  • Growth instructions
    Tetracycline 12.5 ug/ml
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    none
  • Promoter none

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer atpI/gidB F: CAGTAACTGAACGAGCAGAAG
  • 3′ sequencing primer atpI/gidB R: CTTCGTCAGGTGCAACATGAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Precursor strain: ElectroMAX DH10B E. coli cells

Landing pad cassette at at the aptI/gidB locus includes in this order: I-SceI restriction site - Landing Pad 1 (LP1) sequence - tetA gene - Landing Pad 2 (LP2) sequence - I-SceI restriction site.

This strain was made based on the technology described in the Kulman and Cox 2010 Nucleic Acids Res. paper: Site-specific chromosomal integration of large synthetic constructs. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2847246/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DH10B E. coli aptI/gidB::Landing Pad was a gift from Cammie Lesser (Addgene plasmid # 83036)
  • For your References section:

    Engineering Escherichia coli into a protein delivery system for mammalian cells. Reeves AZ, Spears WE, Du J, Tan KY, Wagers AJ, Lesser CF. ACS Synth Biol. 2015 May 15;4(5):644-54. doi: 10.1021/acssynbio.5b00002. Epub 2015 Apr 24. 10.1021/acssynbio.5b00002 PubMed 25853840