pCA24N_6xHis-TEV-rpsA
(Plasmid #83585)

• Purpose: Express E. coli ribosomal protein S1 with a TEV-cleavable, N-terminal His tag
• Depositing Lab: Nils Walter
• Publication: Lund et al Nucleic Acids Res. 2019 Dec 13. pii: 5674991. doi: 10.1093/nar/gkz1166.

Backbone

• Vector backbone: pCA24N
• Backbone size w/o insert (bp): 4520
• Total vector size (bp): 6191
• Modifications to backbone: Mutate amino acids downstream of His tag from TDPALRA to ENLYFQG to make TEV cleavage site. Remove last 5 C-terminal amino acids which are not present in rpsA.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Use plates with 68 ug/mL chloramphenicol for transformation, then replate onto plates with 170 ug/mL if desired. When growing for protein expression, use 68 ug/mL antibiotic in liquid media.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: rpsA
• Alt name: ribosomal protein S1
• Alt name: JW0894
• Species: Escherichia coli
• GenBank ID: NC_000913.3 (961995..963668) NP_415431
• Entrez Gene: rpsA (a.k.a. b0911, ECK0902, JW0894, ssyF)
• Promoter: p-T5 Lac
• Tag / Fusion Protein:
  • His tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SfiI (destroyed during cloning)
• 3′ cloning site: SfiI (destroyed during cloning)
• 5′ sequencing primer: caggaaacagctatgacc
• 3′ sequencing primer: cgagcgttctgaacaaatcc

Resource Information

• Supplemental Documents:
  • Genbank file for pCA24N_6xHis-TEV_rpsA
• A portion of this plasmid was derived from a plasmid made by: The parent plasmid used as starting material for mutagenesis came from the ASKA library via Professor Janine Maddock (Molecular, Cellular & Developmental Biology, University of Michigan), under whose supervision this work was performed.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry