Skip to main content
Holiday Schedule: Addgene will be closed December 24 - December 31. Order processing and shipping will resume on January 3, 2022. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #83711)


Item Catalog # Description Quantity Price (USD)
Plasmid 83711 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-6NBC-GFP-PGK-Puro-Barcode34 was a gift from Monte Winslow (Addgene plasmid # 83711 ; ; RRID:Addgene_83711)
  • For your References section:

    An in vivo multiplexed small-molecule screening platform. Gruner BM, Schulze CJ, Yang D, Ogasawara D, Dix MM, Rogers ZN, Chuang CH, McFarland CD, Chiou SH, Brown JM, Cravatt BF, Bogyo M, Winslow MM. Nat Methods. 2016 Sep 12. doi: 10.1038/nmeth.3992. 10.1038/nmeth.3992 PubMed 27617390