Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRSF-Ivy-his-hLYZ
(Plasmid #83920)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 83920 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRSFDuet-1
  • Total vector size (bp) 4514
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Ivy
  • Alt name
    Inhibitor of vertebrate lysozyme
  • Species
    E. coli
  • Mutation
    Ivy leader sequence deleted and replaced.
  • Promoter T7
  • Tag / Fusion Protein
    • Ivy protein has C-terminal hisx6 tag (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ggatctcgacgctctccct
  • 3′ sequencing primer gattatgcggccgtgtacaa
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    lysozyme
  • Alt name
    human lysozyme
  • Species
    H. sapiens (human)
  • Promoter t7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ttgtacacggccgcataatc
  • 3′ sequencing primer gctagttattgctcagcgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSF-Ivy-his-hLYZ was a gift from Karl Griswold (Addgene plasmid # 83920 ; http://n2t.net/addgene:83920 ; RRID:Addgene_83920)
  • For your References section:

    Engineering Escherichia coli for soluble expression and single step purification of active human lysozyme. Lamppa JW, Tanyos SA, Griswold KE. J Biotechnol. 2013 Mar 10;164(1):1-8. doi: 10.1016/j.jbiotec.2012.11.007. Epub 2012 Dec 7. 10.1016/j.jbiotec.2012.11.007 PubMed 23220215