Gma-pCAMBIA-1301-STTM408
(Plasmid
#84082)
-
PurposeDisturb the expression of miR408 in soybean
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84082 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAMBIA-1301
-
Backbone manufacturerCAMBIA company
- Backbone size w/o insert (bp) 11827
-
Vector typeBacterial Expression, Yeast Expression, Plant Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Kanamycin, 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemiR408
-
Alt nameGma-miR408
-
SpeciesSoybean
-
Insert Size (bp)2846
- Promoter 2x35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (unknown if destroyed)
- 3′ cloning site PacI (unknown if destroyed)
- 5′ sequencing primer 35S promoter
- 3′ sequencing primer AGGTTTAGTCGTCTCGTGTCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
GenBank/Entrez ID of gene: miRBase (MI0018647-MI0018649, MI0017848)
This plasmid used to disturb miR408’s expression by STTM method invented by Dr. Guiliang Tang’s Lab in Michigan Technological University (Plant cell, 2012), Houghton, MI, USA. The method used to construct this plasmid refers to Tang et al., (Methods, 2012) with minor revision. The STTM sequence in this plasmid may contain discrepancies compared to the reference sequence(s). According to the depositing lab, these mutations should not affect plasmid function. For additional published information regarding this plasmid, please see https://www.cell.com/molecular-plant/pdf/S1674-2052(18)30275-2.pdf?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS1674205218302752%3Fshowall%3Dtrue#
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Gma-pCAMBIA-1301-STTM408 was a gift from Guiliang Tang (Addgene plasmid # 84082 ; http://n2t.net/addgene:84082 ; RRID:Addgene_84082) -
For your References section:
Effective small RNA destruction by the expression of a short tandem target mimic in Arabidopsis. Yan J, Gu Y, Jia X, Kang W, Pan S, Tang X, Chen X, Tang G. Plant Cell. 2012 Feb;24(2):415-27. doi: 10.1105/tpc.111.094144. Epub 2012 Feb 17. 10.1105/tpc.111.094144 PubMed 22345490