Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #84085)


Item Catalog # Description Quantity Price (USD)
Plasmid 84085 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Guiliang Tang (Addgene plasmid # 44182)
  • Backbone size w/o insert (bp) 8608
  • Vector type
    Plant Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Kanamycin
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
  • Promoter 2x35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site PacI (not destroyed)
  • 5′ sequencing primer CACTATCCTTCGCAAGACCCTTCC
  • 3′ sequencing primer CAACACATGAGCGAAACCCTATAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The insert within this plasmid contains a 2x35S promoter, STTM, T35S and CmR. The STTM sequence in the plasmid contains discrepancies compared to the reference sequence. According to the depositing lab, these mutations should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFGC5941-PacI-ath-STTM160 was a gift from Guiliang Tang (Addgene plasmid # 84085 ; ; RRID:Addgene_84085)
  • For your References section:

    Construction of short tandem target mimic (STTM) to block the functions of plant and animal microRNAs. Tang G, Yan J, Gu Y, Qiao M, Fan R, Mao Y, Tang X. Methods. 2012 Oct;58(2):118-25. doi: 10.1016/j.ymeth.2012.10.006. Epub 2012 Oct 23. 10.1016/j.ymeth.2012.10.006 PubMed 23098881