Rhesus AAVS1-CAG-copGFP
(Plasmid
#84209)
-
PurposeRhesus AAVS1 safe harbor gene targeting donor expressing CAG-driven copGFP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84209 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAVS1P-iCAG.copGFP (Plasmid #66577)
- Total vector size (bp) 10499
-
Modifications to backboneThe human AAVS1 homology arms were replaced with rhesus homologous sequences.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameRhesus AAVS1 5’ homology arm
-
Speciesrhesus macaque (Macaca mulatta)
-
Insert Size (bp)700
-
GenBank IDN/A (Chromosome 19:61115597-61116296, the MGSC Merged 1.0/rheMac2 assembly)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (destroyed during cloning)
- 3′ cloning site NotI (destroyed during cloning)
- 5′ sequencing primer tatgaccatgattacgccgccacctccttcaggttccagcttcct (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRhesus AAVS1 3’ homology arm
-
Speciesrhesus macaque (Macaca mulatta)
-
Insert Size (bp)700
-
GenBank IDN/A (Chromosome 19:61114897-61115596, the MGSC Merged 1.0/rheMac2 assembly)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site PmeI (destroyed during cloning)
- 3′ cloning site PmeI (destroyed during cloning)
- 5′ sequencing primer agtcagtgagaatattgtttgactggtgacaaaaagccccatcct (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Rhesus AAVS1-CAG-copGFP was a gift from Cynthia Dunbar (Addgene plasmid # 84209 ; http://n2t.net/addgene:84209 ; RRID:Addgene_84209)