pAav-TP53-PQS1-3xFLAG
(Plasmid #84884)

• Purpose: rAAV-based template for genome engineering of the p53 C-terminus containing PQS1 and 3xFLAG tags and a selection cassette
• Depositing Lab: Sven Eyckerman
• Publication: Vandemoortele et al Sci Rep. 2016 Jun 6;6:27220. doi: 10.1038/srep27220.

Backbone

• Vector backbone: pAav-MCS-PQS1-3xFLAG
• Backbone manufacturer: Eyckerman lab
• Backbone size w/o insert (bp): 4863
• Total vector size (bp): 7031
• Vector type: AAV
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: TP53 genomic region HR1
• Species: H. sapiens (human)
• Insert Size (bp): 1090
• Entrez Gene: TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
• Promoter: no
• Tag / Fusion Protein:
  • PQS1 3xFLAG (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CCTCTGACTTGAGCGTCGAT
• 3′ sequencing primer: TAGGGCGCGATAACTTCGTA

Gene/Insert 2

• Gene/Insert name: TP53 genomic region HR2
• Species: H. sapiens (human)
• Promoter: no

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: GGGAGGATTGGGAAGACAAT
• 3′ sequencing primer: TACTATGGTTGCTTTGACGT

Resource Information

• Supplemental Documents:
  • pAav-TP53-Cter PQS1 3xFLAG.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is a targeting vector for modifying the C-terminus of the TP53 gene by adding two tags. A CRE-removable selection cassette is present.
The forward sequencing primer needs to sequence over an ITR sequence which can be problematic