Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #84917)


Item Catalog # Description Quantity Price (USD)
Plasmid 84917 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4650
  • Total vector size (bp) 4890
  • Vector type
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Promoter mPGK
  • Tag / Fusion Protein
    • PQS2 3xHA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CCTCTGACTTGAGCGTCGAT
  • 3′ sequencing primer TACTATGGTTGCTTTGACGT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Sequencing over ITR sequences may be difficult

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAav-MCS-PQS2-3xHA was a gift from Sven Eyckerman (Addgene plasmid # 84917 ; ; RRID:Addgene_84917)
  • For your References section:

    An extra dimension in protein tagging by quantifying universal proteotypic peptides using targeted proteomics. Vandemoortele G, Staes A, Gonnelli G, Samyn N, De Sutter D, Vandermarliere E, Timmerman E, Gevaert K, Martens L, Eyckerman S. Sci Rep. 2016 Jun 6;6:27220. doi: 10.1038/srep27220. 10.1038/srep27220 PubMed 27264994