Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #85495)


Item Catalog # Description Quantity Price (USD)
Plasmid 85495 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 6300
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
    para-cyanophenylalanine Mj synthetase
  • Alt name
  • Alt name
  • Alt name
    p-azidoPhe synthetase
  • Species
    Methanocaldococcus jannaschii
  • Insert Size (bp)
  • Mutation
    Y32L L65V F108W Q109M D158G I159P
  • Promoter lpp (constitutive)
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CGTCACTGCGTCTTTTACTG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDule2-pCNF was a gift from Ryan Mehl (Addgene plasmid # 85495 ; ; RRID:Addgene_85495)
  • For your References section:

    Probing protein folding using site-specifically encoded unnatural amino acids as FRET donors with tryptophan. Miyake-Stoner SJ, Miller AM, Hammill JT, Peeler JC, Hess KR, Mehl RA, Brewer SH. Biochemistry. 2009 Jun 30;48(25):5953-62. doi: 10.1021/bi900426d. 10.1021/bi900426d PubMed 19492814