Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDule2-IBBN (G2)
(Plasmid #85501)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85501 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDule2
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 6300
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    IBBN (G2) synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
  • Alt name
    IBBA (G2) synthetase
  • Alt name
    Bibaf (G2) synthetase
  • Species
    Methanocaldococcus jannaschii
  • Insert Size (bp)
    921
  • Mutation
    Y32G L65E F108W Q109M D158S R162K
  • Promoter lpp (constitutive)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CGTCACTGCGTCTTTTACTG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

This synthetase is permissive and can incorporate a variety of amino acids structurally analogous to IBBN. For a more complete functional and structural analysis of this synthetase, also see Cooley et al. Chembiochem. 2014, 15(12): 1810–1819.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDule2-IBBN (G2) was a gift from Ryan Mehl (Addgene plasmid # 85501 ; http://n2t.net/addgene:85501 ; RRID:Addgene_85501)
  • For your References section:

    Genetically encoded initiator for polymer growth from proteins. Peeler JC, Woodman BF, Averick S, Miyake-Stoner SJ, Stokes AL, Hess KR, Matyjaszewski K, Mehl RA. J Am Chem Soc. 2010 Oct 6;132(39):13575-7. doi: 10.1021/ja104493d. 10.1021/ja104493d PubMed 20839808