Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPEPY-PF6-lacI
(Plasmid #85589)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85589 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pPEPY
  • Backbone size w/o insert (bp) 2963
  • Total vector size (bp) 5925
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Please notice that this vector is a container of lacI gene. Expression of lacI in E. coli makes the cells grow very slowly, So we recommend researcher do PCR with E. coli cells without isolating the plasmid.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    lacI
  • Species
    Synthetic
  • Insert Size (bp)
    2962
  • Promoter PF6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer CCCTAAATTTACTAAAGACACTGCTCA
  • 3′ sequencing primer TGATAGGGTGGTCTCCGATCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For details of the lacI gene and promoter of PF6, please refer to "Robin Sorg, PhD thesis, Engineering Approaches to Investigate Pneumococcal Gene Expression Regulation and Antibiotic Resistance Development, 2016, ISBN: 978-90-367-9259-2"

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPEPY-PF6-lacI was a gift from Jan-Willem Veening (Addgene plasmid # 85589 ; http://n2t.net/addgene:85589 ; RRID:Addgene_85589)
  • For your References section:

    High-throughput CRISPRi phenotyping identifies new essential genes in Streptococcus pneumoniae. Liu X, Gallay C, Kjos M, Domenech A, Slager J, van Kessel SP, Knoops K, Sorg RA, Zhang JR, Veening JW. Mol Syst Biol. 2017 May 10;13(5):931. doi: 10.15252/msb.20167449. PubMed 28490437