Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSH-Csy4-T2A-SpRFN-P2A-GFP-multi-gRNA
(Plasmid #85756)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85756 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSQT-1601
  • Backbone manufacturer
    Shengdar Q Tsai from Keith Joung lab
  • Backbone size w/o insert (bp) 3565
  • Total vector size (bp) 10425
  • Modifications to backbone
    U6-gRNA expression cassette inserted; CAG promoter exchanged for CMV promoter. P2A-GFP insertion added.
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Csy4-T2A-SpRFN-P2A-GFP
  • Alt name
    FokI-dCas9
  • Alt name
    RNA-guided FokI-nuclease
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    6294
  • Mutation
    D10A, H840A
  • Promoter CMV
  • Tags / Fusion Proteins
    • FokI fusion via 25 amino acid (GGGGS)5 linker (N terminal on insert)
    • GFP (C terminal on backbone)
    • Csy4 (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gtttgactcacggggatttc
  • 3′ sequencing primer ttttggcagagggaaaaaga
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    gRNA
  • Alt name
    guide RNA
  • Species
    Synthetic
  • Insert Size (bp)
    148
  • Promoter U6
  • Tag / Fusion Protein
    • Csy4 recognition sequence (N terminal on insert)

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSH-Csy4-T2A-SpRFN-P2A-GFP-multi-gRNA was a gift from Lawrence Stanton (Addgene plasmid # 85756 ; http://n2t.net/addgene:85756 ; RRID:Addgene_85756)
  • For your References section:

    Re-engineered RNA-Guided FokI-Nucleases for Improved Genome Editing in Human Cells. Havlicek S, Shen Y, Alpagu Y, Bruntraeger MB, Zufir NB, Phuah ZY, Fu Z, Dunn NR, Stanton LW. Mol Ther. 2017 Feb 1;25(2):342-355. doi: 10.1016/j.ymthe.2016.11.007. 10.1016/j.ymthe.2016.11.007 PubMed 28153087