Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCaRNA3-eIFiso4E120(+)
(Plasmid #86092)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86092 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCass4Rz
  • Backbone manufacturer
    Dr. Rao (University of California at Riverside)
  • Backbone size w/o insert (bp) 11000
  • Total vector size (bp) 11120
  • Vector type
    Plant Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eIFiso4E
  • Species
    peach (Prunus persica)
  • Insert Size (bp)
    120
  • GenBank ID
    ppa011357m ppa011357m

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba I (not destroyed)
  • 3′ cloning site Xba I (not destroyed)
  • 5′ sequencing primer CTTGTGGGGCCCACTGCTCGGCTGT
  • 3′ sequencing primer ATGGCGACAGAGGTAGCAGCAGCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCaRNA3-eIFiso4E120(+) was a gift from Aiming Wang (Addgene plasmid # 86092 ; http://n2t.net/addgene:86092 ; RRID:Addgene_86092)
  • For your References section:

    An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene. Cui H, Wang A. Plant Biotechnol J. 2016 Aug 27. doi: 10.1111/pbi.12629. 10.1111/pbi.12629 PubMed 27565765