pTcI-Wasabi
(Plasmid
#86101)
-
PurposemWasabi reporter gene gated by temperature-sensitive Lambda repressor TcI
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86101 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepETDuet-1
-
Backbone manufacturerNovagen
-
Modifications to backboneReplaced T7 Promoter #1 with pR/pL Promoter. Replaced T7 Promoter #2 with LacI Promoter.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTcI
-
Alt namecI842
-
Alt nameLambda Repressor
-
SpeciesBacteriophage Lambda
-
Insert Size (bp)714
-
MutationA67T
- Promoter pR/pL, LacI
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer gcttgcggccgcataa
- 3′ sequencing primer CTAGTTATTGCTCAGCGGTG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemWasabi
-
Insert Size (bp)756
-
GenBank IDEU024648.1
- Promoter pR/pL
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (destroyed during cloning)
- 5′ sequencing primer ATGCGTCCGGCGTAGA
- 3′ sequencing primer ttatgcggccgcaagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTcI-Wasabi was a gift from Mikhail Shapiro (Addgene plasmid # 86101 ; http://n2t.net/addgene:86101 ; RRID:Addgene_86101) -
For your References section:
Tunable thermal bioswitches for in vivo control of microbial therapeutics. Piraner DI, Abedi MH, Moser BA, Lee-Gosselin A, Shapiro MG. Nat Chem Biol. 2017 Jan;13(1):75-80. doi: 10.1038/nchembio.2233. Epub 2016 Nov 14. 10.1038/nchembio.2233 PubMed 27842069