pGBKT7-CUS2
(Plasmid
#87558)
-
PurposeEncodes Y2H Gal4 DNA binding domain for Cus2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87558 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGBKT7
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 7300
- Total vector size (bp) 8136
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCUS2
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)871
-
GenBank IDNP_014113.1
-
Entrez GeneCUS2 (a.k.a. YNL286W)
-
Tags
/ Fusion Proteins
- GAL4 BD (N terminal on backbone)
- Myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CCTGCATATGGATGCTGATGAATTGGAATTG
- 3′ sequencing primer caccttctactggaatatatccctagg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGBKT7-CUS2 was a gift from Aaron Hoskins (Addgene plasmid # 87558 ; http://n2t.net/addgene:87558 ; RRID:Addgene_87558) -
For your References section:
SF3b1 mutations associated with myelodysplastic syndromes alter the fidelity of branchsite selection in yeast. Carrocci TJ, Zoerner DM, Paulson JC, Hoskins AA. Nucleic Acids Res. 2017 Jan 6. pii: gkw1349. doi: 10.1093/nar/gkw1349. 10.1093/nar/gkw1349 PubMed 28062854