Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHT-497
(Plasmid #87756)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 87756 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pND1 with modified restriction sites
  • Backbone manufacturer
    see Biochim Biophy Acta. 1990; 1050(1–3): 18–26.
  • Backbone size w/o insert (bp) 2217
  • Total vector size (bp) 3733
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gene coding for rat DYRK1A kinase domain (residues 1-497)
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1516
  • GenBank ID
    XM_008768565.2
  • Promoter T7 RNA polymerase promoter
  • Tag / Fusion Protein
    • 6X histidine tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Cla I (not destroyed)
  • 3′ cloning site Xho I (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGGA
  • 3′ sequencing primer AATTAACCCTCACTAAAGGGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Requires strains with T7 RNA polymerase (e.g. BL21) for expression

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHT-497 was a gift from Yu-Wen Hwang (Addgene plasmid # 87756 ; http://n2t.net/addgene:87756 ; RRID:Addgene_87756)