Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHES820
(Plasmid #89190)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89190 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pNH604
  • Backbone size w/o insert (bp) 6559
  • Total vector size (bp) 7950
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    pGAL1-YFP
  • Species
    S. cerevisiae (budding yeast), Synthetic
  • Insert Size (bp)
    1391
  • Promoter GAL1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PspOMI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer AACTAATCAGCGGTACCGGG
  • 3′ sequencing primer CGCACTCACGTAAACACTTAATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHES820 was a gift from Hana El-Samad (Addgene plasmid # 89190 ; http://n2t.net/addgene:89190 ; RRID:Addgene_89190)
  • For your References section:

    Robust Synthetic Circuits for Two-Dimensional Control of Gene Expression in Yeast. Aranda-Diaz A, Mace K, Zuleta I, Harrigan P, El-Samad H. ACS Synth Biol. 2016 Dec 27. doi: 10.1021/acssynbio.6b00251. 10.1021/acssynbio.6b00251 PubMed 27930885