pFS485
(Plasmid #89348)

• Purpose: Leu1 integrating plasmid with cdc25 genomic fragment
• Depositing Lab: Nick Rhind
• Publication: Keifenheim et al Curr Biol. 2017 May 22;27(10):1491-1497.e4. doi: 10.1016/j.cub.2017.04.016. Epub 2017 May 4.

Backbone

• Vector backbone: pJK148
• Backbone manufacturer: Keeney and Boeke, Genetics, 136:849 (1994)
• Total vector size (bp): 10048
• Modifications to backbone: cdc25 genomic fragment cloned into pJK148 with KpnI and SacI
• Vector type: Yeast Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: cdc25
• Species: S. pombe (fission yeast)
• Insert Size (bp): 2804
• Entrez Gene: cdc25 (a.k.a. SPAC24H6.05, sal2)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: TGTAAAACGACGGCCAGT
• 3′ sequencing primer: CATGGTCATAGCTGTTTCCTG

Resource Information

• Supplemental Documents:
  • pFS485.ape.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry