pLL3.7m-psMEK2
(Plasmid
#89363)
-
PurposeA lenti-viral vector expressing photoswitchable MEK2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 89363 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLL3.7m
-
Backbone manufacturerLuk Parijs
- Backbone size w/o insert (bp) 6500
-
Modifications to backbone5' and 3' UTRs of HIV transcript reduced while retaining essential packaging elements
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepsMEK2
-
Alt namephotoswitchable MEK2
-
Alt namephotoswitchable MAPKK2
-
Alt namephotoswitchable MAP2K2
-
SpeciesH. sapiens (human), Synthetic
-
Entrez GeneMAP2K2 (a.k.a. CFC4, MAPKK2, MEK2, MKK2, PRKMK2)
- Promoter CMV
-
Tags
/ Fusion Proteins
- pdDronpa
- Human influenza hemagglutinin (HA) tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGATAACAATTTCACACAG
- 3′ sequencing primer CGGCCTTTTTACGGTTCCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLL3.7m-psMEK2 was a gift from Michael Lin (Addgene plasmid # 89363 ; http://n2t.net/addgene:89363 ; RRID:Addgene_89363) -
For your References section:
Optical control of cell signaling by single-chain photoswitchable kinases. Zhou XX, Fan LZ, Li P, Shen K, Lin MZ. Science. 2017 Feb 24;355(6327):836-842. doi: 10.1126/science.aah3605. 10.1126/science.aah3605 PubMed 28232577