pMT2 Cav2.2 DomI and DomII
(Plasmid #89891)

• Purpose: Mammalian expression of Cav2.2 DomI and DomII, this contains the first 2 domains (amino acids 1 -1154) of Cav2.2
• Depositing Lab: Annette Dolphin
• Publication: Raghib et al J Neurosci. 2001 Nov 1;21(21):8495-504.

Backbone

• Vector backbone: pMT2
• Backbone size w/o insert (bp): 5129
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cacna1b
• Alt name: Alpha1B
• Insert Size (bp): 3505
• Mutation: Stop codon after amino acid 1154 (this is a truncated form of the wild type gene)
• Entrez Gene: CACNA1B
• Promoter: adenovirus major late promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: 5' agcttgaggtgtggcaggctt 3'
• 3′ sequencing primer: 5' ggtcgaaccatgatggcagc 3'

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Contains Cav2.2 N-terminus, Domain I, the I-II loop, Domain II and the II-III loop.