This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

GFP-ataxin-3 N-t
(Plasmid #89980)


Item Catalog # Description Quantity Price (USD)
Plasmid 89980 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    construct contains aa 1-182; deleted aa 183-361
  • Entrez Gene
    ATXN3 (a.k.a. AT3, ATX3, JOS, MJD, MJD1, SCA3)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GATCACATGGTCCTGCTG
  • 3′ sequencing primer TTTAAAGCAAGTAAAACCTC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-ataxin-3 N-t was a gift from Nico Dantuma (Addgene plasmid # 89980)
  • For your References section:

    Ataxin-3 consolidates the MDC1-dependent DNA double-strand break response by counteracting the SUMO-targeted ubiquitin ligase RNF4. Pfeiffer A, Luijsterburg MS, Acs K, Wiegant WW, Helfricht A, Herzog LK, Minoia M, Bottcher C, Salomons FA, van Attikum H, Dantuma NP. EMBO J. 2017 Mar 8. pii: e201695151. doi: 10.15252/embj.201695151. 10.15252/embj.201695151 PubMed 28275011