Plasmid 9029: 1068 pGL3 FasL promoter (no SV40 prom)

• Gene/insert name: Fas ligand promoter
• Insert size: 100
• Species: H. sapiens (human)
• Fusion protein or tag: luciferase
• Terminal: C terminal on backbone
• Mutation: Removed the SV40 promoter from pGL3
• Vector backbone: pGL3 promoter
  (Search Vector Database)
• Vector type: Mammalian Expression, Luciferase
• Backbone size w/o insert: 4810
• Cloning site 5': NheI
• Site destroyed during cloning: No
• Cloning site 3': BglII
• Site destroyed during cloning: No
• 5' sequencing primer: RVprimer3
• Bacterial resistance(s) Ampicillin
• Growth strain(s) DH5alpha
• Growth temperature (℃): 37
• High or low copy: High Copy
• Sequence: View sequences (1)
• Map: View map
• Principal Investigator: William Sellers
• Terms and Licenses: MTA
  Luciferase Limited Use Label License

Comments: 

Oligonucleotides 5'-GCGCGCTAGCGTGACAGAGTGAGACTCTGTCTCTATTTAAATAAATAAGTAAATAAATAAAC-3' and 5'-GGGG AGATCTGCTTTGTATTTCACAATGTTTTCATTTTCATTGTTTGCCCAG TTTATTTATTT-3', containing the forkhead site of the FasL promoter, were phosphorylated, annealed, and ligated to pGL3-promoter restricted with BglII and NheI to give pGL3-promoter-FasL. This plasmid was subsequently restricted with BglII and HindIII, blunted, and ligated to remove the simian virus 40

Article: Forkhead transcription factors are critical effectors of cell death and cell cycle arrest downstream of PTEN. Nakamura et al (Mol Cell Biol. 2000 Dec . 20(23):8969-82. PubMed)