Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pX330.sgNf1.4
(Plasmid #92028)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 92028 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgNf1.4
  • gRNA/shRNA sequence
    GATTATCCGAATTCTTAGCA
  • Species
    M. musculus (mouse)
  • GenBank ID
    NC_000077

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330.sgNf1.4 was a gift from Wen Xue (Addgene plasmid # 92028 ; http://n2t.net/addgene:92028 ; RRID:Addgene_92028)
  • For your References section:

    Genome-Wide CRISPR Screen Identifies Regulators of Mitogen-Activated Protein Kinase as Suppressors of Liver Tumors in Mice. Song CQ, Li Y, Mou H, Moore J, Park A, Pomyen Y, Hough S, Kennedy Z, Fischer A, Yin H, Anderson DG, Conte D Jr, Zender L, Wang XW, Thorgeirsson S, Weng Z, Xue W. Gastroenterology. 2017 Apr;152(5):1161-1173.e1. doi: 10.1053/j.gastro.2016.12.002. Epub 2016 Dec 10. 10.1053/j.gastro.2016.12.002 PubMed 27956228