iRFP-PAmCherry1-PH_GRP1
(Plasmid
#92168)
-
PurposePI(3,4,5)P3 single molecule fluorescent reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92168 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameiRFP-PAmCherry1-PHgrp1
-
Insert Size (bp)2000
- Promoter CMV
-
Tag
/ Fusion Protein
- iRFP-PAmCherry1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
iRFP-PAmCherry1-PH_GRP1 was a gift from Xuelin Lou (Addgene plasmid # 92168 ; http://n2t.net/addgene:92168 ; RRID:Addgene_92168) -
For your References section:
Nanoscale Landscape of Phosphoinositides Revealed by Specific Pleckstrin Homology (PH) Domains Using Single-molecule Superresolution Imaging in the Plasma Membrane. Ji C, Zhang Y, Xu P, Xu T, Lou X. J Biol Chem. 2015 Nov 6;290(45):26978-93. doi: 10.1074/jbc.M115.663013. Epub 2015 Sep 22. 10.1074/jbc.M115.663013 PubMed 26396197