shNg Lenti FHRC3J1UGW
(Plasmid
#92233)
-
Purposelentiviral expression of EGFP and Ng shRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92233 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFUGW
-
Backbone manufacturerDavid Baltimore (Addgene plasmid # 14883)
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshRNA targeting Ng
-
gRNA/shRNA sequenceGTGACAAGACTTCCCTACTGT
-
SpeciesH. sapiens (human)
- Promoter H1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer H1 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
shNg Lenti FHRC3J1UGW was a gift from Weifeng Xu (Addgene plasmid # 92233 ; http://n2t.net/addgene:92233 ; RRID:Addgene_92233) -
For your References section:
Neurogranin, Encoded by the Schizophrenia Risk Gene NRGN, Bidirectionally Modulates Synaptic Plasticity via Calmodulin-Dependent Regulation of the Neuronal Phosphoproteome. Hwang H, Szucs MJ, Ding LJ, Allen A, Ren X, Haensgen H, Gao F, Rhim H, Andrade A, Pan JQ, Carr SA, Ahmad R, Xu W. Biol Psychiatry. 2021 Feb 1;89(3):256-269. doi: 10.1016/j.biopsych.2020.07.014. Epub 2020 Jul 29. 10.1016/j.biopsych.2020.07.014 PubMed 33032807