Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PhOTO-N (pMTB:memb-Cerulean-2A-H2B-Dendra2)
(Plasmid #92400)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 92400 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMTB
  • Backbone size w/o insert (bp) 6079
  • Total vector size (bp) 8358
  • Vector type
    Zebrafish Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Dendra2
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • GenBank ID
    GU734658.1
  • Tag / Fusion Protein
    • H2B tag (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer SP6 - atttaggtgacactatagaagag
  • 3′ sequencing primer ccttagtcaccgccttcttg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Cerulean
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • GenBank ID
    KP666136.1
  • Tag / Fusion Protein
    • membrane tag (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer caggaGAGGGCAGAGGAA
  • 3′ sequencing primer T7 - CCGCTGAGCAATAACTAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PhOTO-N (pMTB:memb-Cerulean-2A-H2B-Dendra2) was a gift from Periklis Pantazis (Addgene plasmid # 92400 ; http://n2t.net/addgene:92400 ; RRID:Addgene_92400)
  • For your References section:

    PhOTO zebrafish: a transgenic resource for in vivo lineage tracing during development and regeneration. Dempsey WP, Fraser SE, Pantazis P. PLoS One. 2012;7(3):e32888. doi: 10.1371/journal.pone.0032888. Epub 2012 Mar 14. 10.1371/journal.pone.0032888 PubMed 22431986